8Department of Plant Pathology, University of California-Davis, Davis, CA 95616, USA; ude.sivadcu@streborcmn (N.M.); ude.sivadcu@nostrebliglr (R.L.G.)Find articles by
8Department of Plant Pathology, University of California-Davis, Davis, CA 95616, USA; ude.sivadcu@streborcmn (N.M.); ude.sivadcu@nostrebliglr (R.L.G.)Find articles by
Tomato spotted wilt virus (TSWV; species Tomato spotted wilt orthotospovirus; genus Orthotospovirus; family Tospoviridae) is a thrips-transmitted virus that can cause substantial economic losses to many crops, including tomato (Solanum lycopersicum). Since 2005, TSWV emerged as an economically important virus of processing tomatoes in the Central Valley of California, in part due to increased populations of the primary thrips vector, western flower thrips (WFT; Frankliniella occidentalis). To develop an understanding of the epidemiology of TSWV in this region, population densities of WFT and incidence of TSWV were monitored in California’s processing tomato transplant-producing greenhouses and associated open fields from 2007 to 2013. Thrips were monitored with yellow sticky cards and in tomato flowers, whereas TSWV incidence was assessed with indicator plants and field surveys for virus symptoms. All thrips identified from processing tomato fields were WFT, and females were three-fold more abundant on sticky cards than males. Symptoms of TSWV infection were observed in all monitored processing tomato fields. Incidences of TSWV ranged from 1 to 20%, with highest incidence found in late-planted fields. There was no single primary inoculum source, and inoculum sources for thrips/TSWV varied depending on the production region. These results allowed us to develop a model for TSWV infection of processing tomatoes in the Central Valley of California. The model predicts that low levels of primary TSWV inoculum are amplified in early-planted tomatoes and other susceptible crops leading to highest levels of infection in later-planted fields, especially those with high thrips populations. Based upon these findings, an integrated pest management (IPM) strategy for TSWV in processing tomatoes in California was devised. This IPM strategy focuses on strategic field placement (identification of high-risk situations), planting TSWV- and thrips-free transplants, planting resistant varieties, monitoring for TSWV symptoms and thrips, roguing infected plants, thrips management targeting early generations, extensive sanitation after harvest, and strategic cropping to avoid overlap with winter bridge crops.
California produces ~95% of the processing tomatoes (Solanum lycopersicum) in the United States, which represents ~30% of world production [1]. Tomato spotted wilt disease can be a significant constraint on tomato production in tropical and subtropical areas, as well as regions with a Mediterranean climate, such as California [2,3,4,5]. The disease is caused by Tomato spotted wilt virus (TSWV; species Tomato spotted wilt orthotospovirus; genus Orthotospovirus, family Tospoviridae, order Bunyavirales) [6], which is transmitted by several species of thrips, including the western flower thrips (Frankliniella occidentalis Pergande (Thysanoptera: Thripidae) [2,7,8,9,10], which is very common in California. Both TSWV and the thrips vectors have wide host ranges. TSWV has one of the widest host ranges of any plant virus, infecting more than 1000 plant species in 90 families [4,5,11]. Thus, TSWV has been difficult to predict and manage [12,13,14,15,16,17,18]. In California, the disease affects many crops and ornamentals, but has not historically been a major problem for processing tomato production [2].
Understanding the biology of the thrips vector(s) is critical to understand the epidemiology of TSWV in a given geographic region. TSWV is not seed-transmitted [19,20], nor does mechanical transmission seem to play a role in its spread in nature. Thus, the main means of the virus spread into and within (tomato) fields is by the thrips vector. Furthermore, TSWV replicates in the thrips vector but, for adults to become viruliferous, the virus must be acquired by larvae [21,22,23,24,25]. Following acquisition by thrips larvae, the virus quickly infects the midgut, surrounding muscle cells, and tubular salivary glands, while in the late second instar, just prior to pupation, and in adult stages it infects the principal salivary glands from which it can be transmitted for the life of the insect [26]. Importantly, the virus is not passed through the egg [21,22,25,27]. Consequently, plants that serve as hosts of both thrips and TSWV are the most important TSWV inoculum sources. Although thrips are not strong fliers, they commonly fly and can be carried longer distances on wind currents or even on clothing [7]. As thrips can survive and reproduce on a diversity of plants and TSWV has a wide host range, many plants have the potential to serve as sources of TSWV, but the most important hosts may vary depending on the geographic location. To understand and manage TSWV development in a crop in a given geographical region, it is critical to know when and from where viruliferous adult thrips enter fields. Thus, understanding the population dynamics of thrips and the ecology of the virus in an area where TSWV occurs is the first step towards developing an integrated pest management (IPM) strategy for thrips and TSWV.
In 2005, a major outbreak of TSWV and thrips occurred in the Central Valley of California, especially in Fresno County. This outbreak resulted in millions of dollars of loss to processing tomato producers. In 2007, a project was initiated to understand the nature of this outbreak, including population dynamics of thrips, TSWV inoculum sources and temporal aspects of disease development, with the goal of developing an IPM strategy. Through an extensive monitoring program for thrips and TSWV, it was established that tomato transplants from the monitored facilities were not major inoculum sources, nor did they support substantial thrips populations. There was a very low incidence of TSWV in most weed species, however, there were notable exceptions. For example, rough-seeded buttercup (Ranunculus muricatus) had a high incidence of TSWV infection (greater than 85%) and may have had a significant role in the outbreaks of TSWV in some areas. Bridge crops such as radicchio can be inoculum sources for TSWV and viruliferous thrips with their relative importance dependent on geographic location. The phenology of TSWV in tomato as it relates to thrips populations also proved to be an important component in understanding the disease. These investigations have been woven together to create a thrips/TSWV IPM strategy for deployment in the Central Valley of California. Our strategies create a model for management that can be applied wherever thrips and orthotospoviruses are a problem.
Tomato spotted wilt virus (TSWV) is a destructive plant virus that can wreak havoc on autumn sage plants This tricky disease requires diligent monitoring and proactive care to keep under control. By understanding the disease cycle and implementing preventative measures, you can effectively manage TSWV on your autumn sage.
What is Tomato Spotted Wilt Virus?
Tomato spotted wilt virus is one of the most damaging viruses affecting ornamental and food crops worldwide. It impacts over 1000 plant species in 82 families. TSWV causes significant economic losses, especially in solanaceous crops like tomatoes, peppers and eggplant.
TSWV infection leads to bronzing, wilting, stunting, and ring spots on leaves. It spreads through tiny insects called thrips which feed on plant sap. Once a plant is infected, there is no cure. The virus multiplies inside the plant’s vascular tissues, eventually killing the plant.
Autumn sage (Salvia greggii) is susceptible to TSWV. Outbreaks can rapidly spread through your garden, decimating sage populations. So taking preventative action is essential for control.
TSWV Disease Cycle
To manage TSWV it’s important to understand how it spreads
-
Virus reservoirs – TSWV persists in weed hosts and infected ornamentals. Tomato spotted wilt virus does not travel far on its own, so nearby reservoir plants are the main initial source.
-
Thrips acquire virus – Larval thrips feed on infected reservoirs, acquiring TSWV particles on their mouthparts. Adult thrips cannot pick up the virus.
-
Thrips transmit virus – After feeding on a virus reservoir as a larvae, adult thrips can transmit TSWV to healthy plants for the rest of their lives.
-
Infected plant spreads virus – Once a plant is infected, the virus replicates and spreads throughout its tissues. The infected plant now becomes a source of virus for more thrips to acquire.
-
Thrips spread virus to more plants – Thrips spread TSWV as they move from plant to plant feeding. A single thrips can infect multiple plants.
Breaking this cycle is key to controlling tomato spotted wilt virus.
Identifying TSWV Infection in Autumn Sage
Check autumn sage frequently for early symptoms of TSWV infection:
- Bronzed, purplish or yellowed foliage
- Dry, necrotic spots or rings on leaves
- Stunted growth
- Wilting and dieback
- Distorted new leaves
These symptoms start on individual stems or branches then spread. Look for the characteristic ring spots which are a hallmark of TSWV. The sooner infections are detected, the better the chances of limiting spread.
Preventing TSWV Infection in Autumn Sage
Stop TSWV before it starts using these proactive measures:
Start with Clean Plants
- Purchase autumn sage from reputable nurseries
- Inspect new plants closely for virus symptoms
- Quarantine new additions for 2-3 weeks before introducing to your landscape
Control Thrips Populations
- Monitor for thrips on yellow sticky cards
- Apply insecticidal soap or neem oil to deter thrips
- Introduce beneficial predators like ladybugs, lacewings or predatory mites
- Use reflective mulch to confuse thrips and disrupt feeding
Practice Good Gardening Hygiene
- Disinfect tools between plants
- Promptly remove infected plant material
- Control weed reservoirs in the landscape
Choose Resistant Varieties
- Some autumn sage varieties have genetic resistance to TSWV
- ‘PWIN DWARF’ and ‘MRS. WILLMOTT’S COMPACT’ sage show tolerance
Optimize Growing Conditions
- Avoid stressing plants with under or over watering
- Ensure sage receives sufficient but not excessive fertilizer
- Group sage plants closely to deter thrips
Continuously monitoring for symptoms and thrips while diligently implementing preventative measures offers the best protection against this virus.
Managing Existing TSWV Infections in Autumn Sage
If prevention fails and your autumn sage still becomes infected:
Immediately Remove Infected Plants
- Uproot and discard symptomatic autumn sage plants promptly
- Double bag plant debris and dispose of off-site
- Sterilize tools after each cut to avoid spreading virus
Continue Thrips Management
- Treat surrounding plants with insecticidal soap weekly
- Release predatory mites or nematodes
- Remove any flowering weeds which attract thrips
Promote General Plant Health
- Keep autumn sage well fed and watered
- Use plant strengtheners like kelp extract or compost tea
- Avoid excess nitrogen which encourages lush, tender growth attractive to thrips
Monitor Diligently
- Check remaining plants twice weekly for symptoms
- Treat new infections aggressively to contain spread
Consider Replanting with Resistant Varieties
- Remove all infected sage plants at end of season
- Test soil for TSWV before replanting
- Replant cleaned beds with TSWV resistant sage varieties
Remain vigilant with monitoring and control measures even after infections occur. Quickly treating symptoms and managing thrips is key to salvaging your remaining autumn sage plants.
Using Integrated Pest Management Against TSWV
An integrated approach combining cultural practices, resistant plants, and targeted chemical control provides the best protection against tomato spotted wilt virus.
Cultural practices like cleanliness, weed control, companion planting, and hygiene techniques reduce virus spread.
Resistant plant varieties insusceptible to the virus break the disease cycle.
Chemical control through insecticides, horticultural oils, and soaps kills thrips, but must be used judiciously to minimize environmental impact.
Layering these IPM strategies provides effective, environmentally responsible TSWV control. The goal is disrupting the disease triangle of virus, plant host, and thrips vector to keep autumn sage healthy and thriving despite threat of infection.
While tomato spotted wilt virus can be challenging to manage, knowledge of the TSWV disease cycle reveals clear control points. Attacking the disease triangle with integrated pest management, proactive prevention, and prompt treatment of symptoms allows successful control on susceptible autumn sage plants. Remain vigilant in monitoring and implementing control measures to protect your autumn sage from this destructive virus. With persistence and dedication to good gardening practices, you can enjoy vibrant, thriving stands of autumn sage.
8. Detection of TSWV in Thrips by RT-PCR
Thrips collected from flowers or yellow sticky cards were used for RT-PCR detection of TSWV in thrips. Thrips were recovered from yellow sticky cards by gently removing with a pipette tip and then placing these thrips in 0.5 mL of hexane (Fisher Scientific, Waltham, MA, USA) in a 1.5 mL Eppendorf tube to remove the adhesive material. Thrips were kept in hexane until they were free of aggregation, and the hexane was removed by pipette. Adult thrips recovered from yellow sticky cards and adults and larval thrips collected from flowers (in 70% ethanol), were placed in 1.5 mL Eppendorf tubes and washed with 70% and 100% ethanol. After removal of the 100% ethanol, thrips were air-dried and used immediately for RNA extraction or stored at −20 °C. Total RNA was extracted from thrips with the Qiagen RNeasy kit (Qiagen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Positive controls were thrips that were reared on TSWV-infected Datura stramonium plants. RT-PCR analysis of thrips (individual or pools of 10–100 insects) with the TSWV N gene-specific primers was performed as described above for plant tissues. Additionally, to confirm integrity of the RNA extracted from thrips, PCR with a universal primer pair for the insect actin gene was used to direct the amplification of the WFT actin gene [78].
6. Molecular Characterization and Detection of TSWV From Plants by RT-PCR
From 2007 to 2013, selected crop and weed plants with TSWV symptoms, or in a few cases without obvious symptoms, were confirmed to be infected with TSWV by immunostrip or RT-PCR. To detect TSWV by RT-PCR and to determine the genetic diversity of TSWV isolates, total RNA was extracted from leaf or fruit tissues with the Qiagen RNeasy kit (Qiagen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The complete N gene sequence (777 nt) was amplified by RT-PCR with the primer pair, TSWV N1F (5′ATGTCTAAGGTTAAGCTCAC3′) and TSWV N777C (5′TTAAGCAAGTTCTGTGAGTT3′) [119], total RNA and SuperScriptII reverse transcriptase (Invitrogen, Carlsbad, CA, USA). PCR was performed with Choice Taq DNA polymerase (Denville Sci. Inc., Saint-Laurent QC, Canada). PCR-amplified cDNA fragments were purified from agarose gels with the Qiaquick PCR Purification Kit (Qiagen, Carlsbad, CA, USA), and either cloned into the TOPO TA PCR Vector (Invitrogen, Carlsbad, CA, USA) and sequenced or directly sequenced at the UC Davis Sequencing Facility.
UGA Conducts Studies To Combat Tomato Spotted Wilt Virus
FAQ
How do you get rid of tomato wilt?
Will tomato plants recover from Fusarium wilt?
What are the host plants for tomato spotted wilt?
Can you eat tomatoes with spotted wilt virus?
What is tomato spotted wilt virus (TSWV)?
Tomato spotted wilt virus (TSWV) affects tomato plants and is spread by thrips. It causes brown ring spots on leaves, wilting of plants, and misshapen fruits. There is no cure for virus-infected plants and so, remove them to prevent the spread of the virus.
Can Tomato plants get spotted wilt virus?
Figure 1: Tomato spotted wilt virus often causes a ringspot lesion on tomato leaves. Figure 2: In severe cases, tomato fruit may become distorted by infection with tomato spotted wilt virus. The easiest way to avoid having your tomato plants get TSWV is to grow tomato plants and flowers in separate greenhouses.
What is tomato spotted wilt?
Spotted wilt in tomato was first discovered in Australia more than a century ago and was eventually determined to be a viral disease transmitted by thrips. Since that time, it has spread to countries around the world. Read on to learn about tomato spotted wilt treatment. Tomato spotted wilt virus affects hundreds of plant species.
How do thrips get tomato spotted wilt virus?
And usually, the thrips get the virus from ornamental plants such as flowers which may be grown together with tomato plants. Figure 1: Tomato spotted wilt virus often causes a ringspot lesion on tomato leaves. Figure 2: In severe cases, tomato fruit may become distorted by infection with tomato spotted wilt virus.